Homo sapiens angiotensin I converting enzyme 2 (ACE2), mRNA.
Vector
pUC
Sequence
atgtcaagctcttcctggctccttctcagccttgttgctgtaactgctgctcagtccaccattgaggaacaggccaagacatttttggacaagtttaaccacgaagccgaagacctgttctatcaaagttcacttgcttcttggaattataacaccaatattactgaagagaatgtccaaaacatgaataatgctggggacaaatggtctgcctttttaaaggaacagtccacacttgcccaaatgtatccactacaagaaattcagaatctcacagtcaagcttcagctgcaggctcttcagcaaaatgggtcttcagtgctctcagaagacaagagcaaacggttgaacacaattctaaatacaatgagcaccatctacagtactggaaaagtttgtaacccagataatccacaagaatgcttattacttgaaccaggtttgaatgaaataatggcaaacagtttagactacaatgagaggctctgggcttgggaaagctggagatctgaggtcggcaagcagctgaggccattatatgaagagtatgtggtcttgaaaaatgagatggcaagagcaaatcattatgaggactatggggattattggagaggagactatgaagtaaatggggtagatggctatgactacagccgcggccagttgattgaagatgtggaacatacctttgaagagattaaaccattatatgaacatcttcatgcctatgtgagggcaaagttgatgaatgcctatccttcctatatcagtccaattggatgcctccctgctcatttgcttggtgatatgtggggtagattttggacaaatctgtactctttgacagttccctttggacagaaaccaaacatagatgttactgatgcaatggtggaccaggcctgggatgcacagagaatattcaaggaggccgagaagttctttgtatctgttggtcttcctaatatgactcaaggattctgggaaaattccatgctaacggacccaggaaatgttcagaaagcagtctgccatcccacagcttgggacctggggaagggcgacttcaggatccttatgtgcacaaaggtgacaatggacgacttcctgacagctcatcatgagatggggcatatccagtatgatatggcatatgctgcacaaccttttctgctaagaaatggagctaatgaaggattccatgaagctgttggggaaatcatgtcactttctgcagccacacctaagcatttaaaatccattggtcttctgtcacccgattttcaagaagacaatgaaacagaaataaacttcctgctcaaacaagcactcacgattgttgggactctgccatttacttacatgttagagaagtggaggtggatggtctttaaaggggaaattcccaaagaccagtggatgaaaaagtggtgggagatgaagcgagagatagttggggtggtggaacctgtgccccatgatgaaacatactgtgaccccgcatctctgttccatgtttctaatgattactcattcattcgatattacacaaggaccctttaccaattccagtttcaagaagcactttgtcaagcagctaaacatgaaggccctctgcacaaatgtgacatctcaaactctacagaagctggacagaaactgttcaatatgctgaggcttggaaaatcagaaccctggaccctagcattggaaaatgttgtaggagcaaagaacatgaatgtaaggccactgctcaactactttgagcccttatttacctggctgaaagaccagaacaagaattcttttgtgggatggagtaccgactggagtccatatgcagaccaaagcatcaaagtgaggataagcctaaaatcagctcttggagataaagcatatgaatggaacgacaatgaaatgtacctgttccgatcatctgttgcatatgctatgaggcagtactttttaaaagtaaaaaatcagatgattctttttggggaggaggatgtgcgagtggctaatttgaaaccaagaatctcctttaatttctttgtcactgcacctaaaaatgtgtctgatatcattcctagaactgaagttgaaaaggccatcaggatgtcccggagccgtatcaatgatgctttccgtctgaatgacaacagcctagagtttctggggatacagccaacacttggacctcctaaccagccccctgtttccatatggctgattgtttttggagttgtgatgggagtgatagtggttggcattgtcatcctgatcttcactgggatcagagatcggaagaagaaaaataaagcaagaagtggagaaaatccttatgcctccatcgatattagcaaaggagaaaataatccaggattccaaaacactgatgatgttcagacctccttttag
Note: The complete
sequence may include tag sequence, target protein sequence, linker sequence and extra sequence that is
translated with the protein sequence for the purpose(s) of secretion, stability, solubility, etc.
If the exact amino acid sequence of this recombinant protein is critical to your application,
please explicitly request the full and complete sequence of this protein before ordering.
Essential counter-regulatory carboxypeptidase of the renin-angiotensin hormone system that is a critical regulator of blood volume, systemic vascular resistance, and thus cardiovascular homeostasis. Converts angiotensin I to angiotensin 1-9, a nine-amino acid peptide with anti-hypertrophic effects in cardiomyocytes, and angiotensin II to angiotensin 1-7, which then acts as a beneficial vasodilator and anti-proliferation agent, counterbalancing the actions of the vasoconstrictor angiotensin II. Also removes the C-terminal residue from three other vasoactive peptides, neurotensin, kinetensin, and des-Arg bradykinin, but is not active on bradykinin. Also cleaves other biological peptides, such as apelins (apelin-13, Non-functional as a carboxypeptidase.; (Microbial infection) Acts as a receptor for human coronaviruses SARS-CoV and SARS-CoV-2, as well as human coronavirus NL63/HCoV-NL63.; (Microbial infection) Non-functional as a receptor for human coronavirus SARS-CoV-2.
Gene References into Functions
Report no influence of ACE2 gene polymorphism on stroke recurrence and only find possible interaction between hypertension history and the ACE2 gene in male stroke patients.PMID:30056001
In a Chinese Han population, five single-nucleotide polymorphisms (SNP) (rs1514283, rs4646155, rs4646176, rs2285666, and rs879922) in ACE2 gene were determined to significantly associate with essential hypertension in female participants, while no SNP locus was linked to male group.PMID:30335025
ACE2 and other enzymes can form ANG-(1-7) directly or indirectly from either the decapeptide ANG I or from ANG II. [review]PMID:29351514
Suggest a potential role for ACE2 polymorphism in postexercise hypotension in hypertensive medicated individuals.PMID:27925380
ACE2 SNPs and haplotypes are associated with circulating angiotensin-(1-7) levels.PMID:28895159
we found an interaction between ACE2 and AGTR1 in structuralatrial fibrillation patients in a Chinese Han populationPMID:29441892
results suggest that ACE2, TNNI3K and CALM3 polymorphisms are associated with increased risk of hypertrophic cardiomyopathies and dilated cardiomyopathies and may act as disease modifiers of these diseases.PMID:28744816
Elevated plasma ACE2 is significantly associated with more advanced LA structural remodeling in atrial fibrillation.PMID:27738071
Overexpression of ACE2 in monocytes led to reduced endothelial adhesion, transmigration and downregulation of adhesion-related molecules and results in atherosclerosis.PMID:28186543
These results indicated that aberrant methylation of the ACE2 promoter may be associated with EH risk. In addition, sex may significantly influence ACE2 methylation.PMID:28440441
ACE2 rs2106809 is an important predictive factor of the response to antihypertensive treatment with ACE inhibitors in Chinese female hypertensive patients.PMID:27121444
In islets from db/db mice, ACE2 over-expression increased intracellular calcium influx and restored impaired mitochondrial oxidation, potentially causing an increase in GSIS. These results shed light on the potential roles of ACE2 in mitochondrial metabolism, moreover, may improve our understanding of diabetes.PMID:29128354
ACE2 may have a role in silent atherosclerosis in patients with chronic kidney disease; it counterbalances the vasoconstrictor adverse effects of angiotensin II by its conversionPMID:27615597
This study reveals an elevated serum concentration of ACE2 and independent associations between serum ACE2 and echocardiographic parameters in hypertensive patients.PMID:28223093
The findings of this study indicate that ACE-2 activity is reduced in AD and is an important regulator of the central classical ACE-1/Ang II/AT1R axis of renin-angiotensin system, and also that dysregulation of this pathway likely plays a significant role in the pathogenesis of Alzheimer's disease.PMID:27884212
Overexpression of ACE2 ameliorates Abeta-induced inflammatory response by activating the ACE2/Ang-(1-7)/Mas axis in human RPE cells.PMID:28605813
Although further studies are required to determine how clusterin suppresses non-specific cellular uptake in phagocytes, our data suggest that clusterin plays a key role in the stealth effect of not only pegylated nanoparticles but also non-pegylated nanoparticles.PMID:27983983
The ACE2 G8790A polymorphism in type 2 diabetes mellitus patients was correlated with cerebral stroke, and the A allele might be a risk factor of type 2 diabetes mellitus combined with cerebral stroke.PMID:27500554
ollectrin, an ACE2 homolog with no catalytic activity, regulates blood pressure through an NO-dependent mechanism. Large body of experimental data confirmed sustained beneficial effects of ACE2/Ang-(1-7)/Mas receptor axis activation on hypertension and vascular injury.PMID:27889958
The potential contribution of the ACE2 to cardiovascular disease progression was addressed.PMID:27965422
Serum ACE2 activity was significantly lower in acute ischemic stroke as compared to both control and stroke-alert patients, followed by an increase to control levels at three days.PMID:27488276
Here, we review the role and effects of ACE2, ACE2 activators, Ang-(1-7) and synthetic Mas receptor agonists in the control of inflammation and fibrosis in cardiovascular and renal diseases and as counter-regulators of the ACE-Ang II-AT1 axis.PMID:26995300
Downregulation of ACE2/Ang-(1-7)/Mas axis stimulates breast cancer metastasis through the activation of store-operated calcium entry and PAK1/NF-kappaB/Snail1 pathways.PMID:27063099
The circulating ACE2 and Ang-(1-7) levels were related to neither rs4646155 nor rs879922 in female or male patients.In conclusion, the rs2106809 polymorphism of the ACE2 gene may be a determinant of the circulating Ang-(1-7) level in female patients with hypertension, suggesting a genetic association between circulating Ang-(1-7) levels and ACE2 gene polymorphisms in patients with hypertension.PMID:27310975
These results indicated that angiotensin-(1-7)/ACE2/Mas axis may reduce liver lipid accumulation partly by regulating lipid-metabolizing genes through ATP/P2 receptor/CaM signaling pathway.PMID:26883384
ACE-2 significantly increased when IMR-90 were hypoxic prior to hyperoxic exposure with no recovery.PMID:27093376
Imbalanced down-regulation of ACE and ACE2 mRNA expression levels may play an important role in the development and progression of thoracic aortic aneurysmal dilatation and subsequently dissection.PMID:25237166
These results suggest that the ACE2 G8790A and rs2106809 polymorphisms may be associated with essential hypertension risk.PMID:25237167
ACE and ACE2 expression at the mRNA and protein levels are significantly increased in the myocardium of patients with heart failure.PMID:25869724
Multivariable regression analysis revealed that urinary L-FABP and urinary albumin/ creatinine ratio were significantly associated with urinary ACE2 levels.PMID:26067610
ACE2 and Ang-(1-7) significantly inhibit early atherosclerotic lesion formation via protection of endothelial function and inhibition of inflammatory response.PMID:25721616
ACE-2 is expressed in fetal human lung fibroblasts but is significantly decreased by hyperoxic gasPMID:25665060
urinary ACE2 increased in type 2 diabetic patients with various degrees of albuminuriaPMID:25791940
soluble ACE2 is involved in the pathomechanism of hypertension and heart failure.PMID:24691269
Decrease in circulating ACE2 activity was associated with cardiovascular disease in patients with chronic kidney disease.PMID:25813276
By genetic replenishment of ACE2 and pharmaceutical use of ARB, restored ACE2 level mitigated GBC growth. Our results supported the rationale for the use of ARB in GBC patients for potential therapeutic benefitPMID:25663464
There is no clear association between ACE2 gene A9570G polymorphisms and childhood primary nephrotic syndrome.PMID:25815490
Our results revealed that SNPs rs2074192 and rs714205 in ACE2 gene were associated with the susceptibility of DR and PDR.PMID:25359286
Olmesartan may uniquely increase urinary ACE2 level in hypertensive patients, which could potentially offer additional renoprotective effects.PMID:24842388
Hepatocellular carcinoma patients with higher level of ACE2 expression had longer survival time than those with lower level of ACE2 expression.PMID:25701390
Urinary ACE2 activity and protein expression are increased in type 1 diabetes patients prior to the onset of clinical complications.PMID:24920267
Brain endoplasmic reticulum stress does not contribute to DOCA-salt hypertension and ACE2 blunts neurogenic hypertension independently of ER stress.PMID:25519733
Partial loss of ACE2 is sufficient to enhance the susceptibility to heart disease.PMID:24728465
These data demonstrate that MSCs modified to overexpress the ACE2 gene can produce biologically active ACE2 protein over a sustained period of time and have an enhanced ability to promote endothelial repair after LPS challengePMID:25200929
ACE2 cleavage is regulated by influenza A H1N1 neuraminidase.PMID:24662240
among females ACE2 rs2106809 polymorphisms,and among males ACE2 rs2106809 polymorphism and alcohol consumption are associated with essential hypertensionPMID:24112034
Data suggest angiotensin (ANG) converting enzyme 2/ANG-II-(1-7)/proto-oncogene protein Mas axis regulates inflammation/fibrosis, cell proliferation, and leukocyte recruitment/activation; main topic here is kidney/inflammatory renal disease. [REVIEW]PMID:23488800
ACE2 and FZD1 are prognosis markers in squamous cell/adenosquamous carcinoma and adenocarcinoma of gallbladder.PMID:23921915
ACE2 overexpression in the rostral ventrolateral medulla attenuates the enhanced tonically active glutamatergic input in SHRs, which may be an important mechanism underlying the beneficial effect of central ACE2 to hypertension.PMID:24838502
Expressed in endothelial cells from small and large arteries, and in arterial smooth muscle cells (at protein level). Expressed in enterocytes of the small intestine, Leydig cells and Sertoli cells (at protein level). Expressed in the renal proximal tubul